POLYMERASE CHAIN REACTION PROTOCOL

©David B. Fankhauser, Ph.D.
Professor of Biology and Chemistry
University of Cincinnati Clermont College,
Batavia OH 45103
 Reagents for the PCR Reaction
modified from the protocol of Sonia Wallman

This page has been accessed Counter times since 23 Feb. 2003. 
19 January 2001, 13 Feb 01, 3 Jan 03, 19 Feb 03
 Insert reaction tubes
into thermocycler

Wear latex gloves at all times when handling DNA.  You will need to have previously isolated DNA for analysis, students isolate their own DNA
 


Program the thermocycler before hand with the prescribed step file (see conditions required for given probe set). For D1S80 primers (primers which work well for us), the step file will be:

SEGMENT TEMP. C TIME
min.
PURPOSE
1 95 5 initial denaturation
2 95 1 cyclic denaturation
3 65 1 annealing of primers
4 72 1 synthesis of DNA
Repeat the 2, 3 and 4 steps for 30 cycles. At the end of the 30 cycles:
TIME DELAY FILE 72 C 10 minutes

Label a 0.5ml PCR tube on the cap with your initials.
PCR Equipment



Prepare reaction mix which contains the following per student sample to be run, assuming DNA sample of 5 L (adjust the dH2O for other volumes of DNA):
    17.35 uL sterile DNA grade dH2O
    3.0 uL 10x PCR buffer
    1.5 uL 50 mM MgCl2
    1.5 uL 10 mM dNTP (10 mM for each of the four nucleotide triphosphates)
    1.5 uL 5 uM primer set (both forward and reverse primers)
Deliver 25 L of reaction mix to each tube on ice.

Add 1 uL of your buccal cell DNA from the previous preparation. (Using 5 uL in the past produced less distinct bands)
Close top of tube securely and mix reagents by vortexing.
Store sample on crushed ice until all samples have been prepared.

 
 

Warm up the thermocycler
Load thermocycler with 0.5ml PCR reaction tubes. 
For hot start, run at 95 C for five minutes, then add 0.15 uL Taq polymerase, 5 units/ uL

Run the thermocycler for prescribed number of cycles so that the polymerase chain reaction amplifies the probed segment of DNA. (This usually requires coming back to the lab several hours later)

Add 5 L of 6x loading dye to the PCR sample. Mix by vortexing. Store all samples on crushed ice for minutes or at -20 Centigrade for days until you are ready to cast agarose gel and electrophorese. 


PCR Gel, Feb 2004  
Here are the resulting D1S80 amplified bands from several genetics students

Here is an image after one hour electrophoresis from 2004.

Here is the same 2004 image labeled.
We had problems in 2005 getting a strong signal.  I ran a trial with fresh reagents.


ALTERNATIVE SOURCES OF DNA:
We also tried using DNA from hair follicles and swabs of cheek and lips.  None of the bands were as strong as those seen with excracted buccla DNA, but the strength of bands produced was cheek>lips>hair.  Here is an image of the gel

Here is information about the probe from the web: http://www.uni-kassel.de/fb19/genetics/activity/LL_1996/datavntr.htm

Max Het:                          0.81
Primer Name:                    D1S80.PCR1.1                                                       Length: 28  Orien: 5'-3'
Sequence:                         GAAACTGGCCTCCAAACACTGCCCGCCG
Primer Name:                    D1S80.PCR1.2                                                        Length: 29  Orien: 5'-3'
Sequence:                         GTCTTGTTGGAGATGCACGTGCCCCTTGC
Amplified Product Size:     0.430 -    0.750  kb                     
 


Here are some very nice looking polyacrylamide gels from the web showing the use of the ladder:

allelic ladder The repeat unit in D1S80 is 16 base pairs (bp) in length and alleles range from approximately 350 to 1,000 bp.  Each band at the left is 16 bp different from its neighbor.  Most alleles range from 14 to 39 repeats .

AmpliFLP™ D1S80 Allelic Ladder can allow specific allele identification.





forensic samples using PCR DNA typing of twins at the D1S80 locus. Silver-stained polyacrylamide gel of PCR products obtained with locus-specific primers and DNA purified from single hair roots using the QIAamp DNA Mini Kit.
    
L:               allele ladder;
A and B:     twins A and B.










Other sites which can be used for similar PCR analysis include VWA and FES:

forensic samples, no. 2 DNA typing of blood samples at the indicated loci. DNA was isolated from the following samples

L:     allele ladder.
C:     fresh control sample using the QIAamp DNA Blood Mini Kit
A:     from the blood-alcohol sampleas detailed above. 


*To initiate hot start PCR, denature the DNA by incubating the tubes for 5 minutes at 95° C (segment 1), maintain the tubes at 95° C while you add 0.4 l Taq DNA polymerase to each tube. Do not allow the tubes to cool and do not take time to mix the reaction mixture after adding the Taq polymerase.